Skip to main content

Table 3 Primer sequences, genes for beta-lactamase and the expected amplicon sizes

From: Antibiogram and beta-lactamase genes among cefotaxime resistant E. coli from wastewater treatment plant

GroupGene namePrimer sequence (5′–3′)Expected amplicon size (bp)
ESBLS genesblaTEMGTCGCCGCATACACTATTCTCA258
CGCTCGTCGTTTGGTATGG
blaCTX-MCGGGAGGCAGACTGGGTGT381
TCGGCTCGGTACGGTCGA
blaSHVGCCTTGACCGCTGGGAAAC319
GGCGTATCCCGCAGATAAAT
Carbapenemase genesblaVIMGATGGTGTTTGGTCGCATA390
CGAATGCGCAGC
blaOXA-1TTCTGTTGTTTGGGTTTCGC190
ACGCAGGAATTGAATTTGTTC
blaKPC-2GCTTCCCACTGTGCAGCTCATTC213
CGCCCAACTCCTCAGCAACAATTG
blaNDM-1GGTGCATGCCCGGTGAAATC660
ATGCTGGCCTTGGGGAACG
\