Skip to main content

Table 2 Primer sequences and amplicon size of PCR-amplified gene targets

From: Antibiogram and beta-lactamase genes among cefotaxime resistant E. coli from wastewater treatment plant

Target speciesGene targetPrimer sequence 5′–3′Amplicon size (bp)
E. coliAlrCTGGAAGAGGCTAGCCTGGACGAG366
AAAATCGGCACCGGTGGAGCGATC
\