Skip to main content

Table 1 Primers used for polymerase chain reaction amplification of extended-spectrum beta-lactamase genes (TEM, SHV and CTX-M-1)

From: Antimicrobial susceptibility and molecular epidemiology of extended-spectrum beta-lactamase-producing Enterobacteriaceae from intensive care units at Hamad Medical Corporation, Qatar

Gene Primer Sequence (5′3′) Amplicon size (bp)
TEM TEM-F
TEM-R
TTCTTGAAGACGAAAGGGC
ACGCTCAGTGGAACGAAAAC
1,150
SHV SHV-F
SHV-R
CACTCAAGGATGTATTGTG
TTAGCGTTGCCAGTGCTCG
885
CTX-M-1 group CTXM1-F
CTXM1-R
GACGATGTCACTGGCTGAGC
AGCCGCCGACGCTAATACA
499